Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 146951574 146960535 enh38506

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 146954766 rs371044657 AATATTAAAGACATTTATTAAAGACATTT A 8597444
chr5 146954766 rs530696077 AATATTAAAGACATTTATTAAAGACATTT A 8597445

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results