Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 147232065 147244755 enh72050

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 147244426 rs146610086 T TGTCCCCTCAGTACCATCCC 8598933
chr5 147244426 rs549044196 T TGTCCCCTCAGTACCATCCC 8598934

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results