EnhancerDB
  1. Home
  2. TFBS
  3. LFA1[chr5:150005668-150005672]
Chromosome characteristics of LFA1[chr5:150005668-150005672]
Back to top
Enhancers possibly regulated by LFA1[chr5:150005668-150005672]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 149998886 150027071 enh22720
Colon (HCT116) Pancreas Uterus Epithelial (MCF-7) Brain (SK-N-SH) Ovary Bone (Osteoblast) Thyroid Neural Stem Cells (H9) Prostate (PC-3) Cervix (HeLa-S3) Esophagus Blood (GM12878) Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Prostate (RWPE1) Muscle (A673) Heart
SNP sites on LFA1[chr5:150005668-150005672]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 150005670 rs141073504 GGCAAGGGGTTGGAAGCCTTACTGGC G 8616331
chr5 150005670 rs368912866 GGCAAGGGGTTGGAAGCCTTACTGGC G 8616332
Genes possibly regulated by LFA1[chr5:150005668-150005672]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by LFA1[chr5:150005668-150005672]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results