Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 156791807 156802035 enh38544

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 156792794 rs143047890 C CTCTGTCATTCAACATTACATT 8641132

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results