EnhancerDB
  1. Home
  2. TFBS
  3. SREBF2[chr5:156795715-156795725]
Chromosome characteristics of SREBF2[chr5:156795715-156795725]
Back to top
Enhancers possibly regulated by SREBF2[chr5:156795715-156795725]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 156791807 156802035 enh38544
Prostate (PC-3) Brain (SK-N-SH) Large Intestine Esophagus Astrocyte Lung (A549) Muscle (A673) Thyroid Muscle (Myotube) Uterus Stomach
SNP sites on SREBF2[chr5:156795715-156795725]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 156795719 rs2910160 G A 8641166
chr5 156795722 rs140130918 TGACAGTTAAGAGTCACTGGTTCCACA T 8641167
chr5 156795722 rs56393914 TGACAGTTAAGAGTCACTGGTTCCACA T 8641168
Genes possibly regulated by SREBF2[chr5:156795715-156795725]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by SREBF2[chr5:156795715-156795725]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results