EnhancerDB
  1. Home
  2. TFBS
  3. PKNOX2[chr5:157843947-157843959]
Chromosome characteristics of PKNOX2[chr5:157843947-157843959]
Back to top
Enhancers possibly regulated by PKNOX2[chr5:157843947-157843959]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 157831968 157844055 enh38556
Skin (Keratinocyte) Prostate (PC-3) Astrocyte Peripheral Blood (MM.1S) Muscle (Myoblast) Spleen Uterus Heart
SNP sites on PKNOX2[chr5:157843947-157843959]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 157843954 rs67170411 GTGACAGTGCAAGGTGGGGGCT G 8647649
chr5 157843954 rs72157187 GTGACAGTGCAAGGTGGGGGCT G 8647650
Genes possibly regulated by PKNOX2[chr5:157843947-157843959]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by PKNOX2[chr5:157843947-157843959]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results