EnhancerDB
  1. Home
  2. TFBS
  3. SP1[chr5:167187896-167187901]
Chromosome characteristics of SP1[chr5:167187896-167187901]
Back to top
Enhancers possibly regulated by SP1[chr5:167187896-167187901]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 167182725 167194575 enh38625
Skin (Keratinocyte) Prostate (PC-3) Prostate (RWPE1) Astrocyte Muscle (A673) Lung (PC-9) Neural Stem Cells (H9)
SNP sites on SP1[chr5:167187896-167187901]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 167187898 rs144083668 CGCCCACCTTGGCCTCCCAAA C 8675472
chr5 167187898 rs536664982 C T 8675473
chr5 167187898 rs59425861 CGCCCACCTTGGCCTCCCAAA C 8675474
Genes possibly regulated by SP1[chr5:167187896-167187901]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by SP1[chr5:167187896-167187901]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results