EnhancerDB
  1. Home
  2. TFBS
  3. LUN1[chr5:171586884-171586905]
Chromosome characteristics of LUN1[chr5:171586884-171586905]
Back to top
Enhancers possibly regulated by LUN1[chr5:171586884-171586905]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 171565199 171613524 enh8878
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Colon (HCT116) Blood (Karpas-422) Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Bone (Osteoblast) Blood (OCI-LY7) Peripheral Blood (MM.1S) Neural Stem Cells (H9) Thymus Prostate (PC-3) Large Intestine Esophagus Blood (GM12878) Placenta Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Heart
SNP sites on LUN1[chr5:171586884-171586905]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 171586893 rs192051690 G T 8698908
chr5 171586900 rs369167481 GGGAGGCCAAGGTGGGCGGATCACAAGGTCA G 8698909
Genes possibly regulated by LUN1[chr5:171586884-171586905]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by LUN1[chr5:171586884-171586905]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results