EnhancerDB
  1. Home
  2. TFBS
  3. NFE[chr5:172076136-172076140]
Chromosome characteristics of NFE[chr5:172076136-172076140]
Back to top
Enhancers possibly regulated by NFE[chr5:172076136-172076140]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 172066065 172079295 enh55595
Cervix (HeLa-S3) Prostate (RWPE1) Large Intestine Esophagus Stomach Lung (PC-9) Uterus Heart
SNP sites on NFE[chr5:172076136-172076140]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 172076137 rs375614617 CTGTCTGGAGCTGGACAGCGGGGAGAACG C 8703089
chr5 172076137 rs536748936 CTGTCTGGAGCTGGACAGCGGGGAGAACG C 8703090
Genes possibly regulated by NFE[chr5:172076136-172076140]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by NFE[chr5:172076136-172076140]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr5 172089225 172089245 + hsa-miR-5003-3p MIMAT0021026 172068273 0.916667 0.0 7863 1343
Expression level of miRNAs
Back to top