Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 172066065 172079295 enh55595

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 172076137 rs375614617 CTGTCTGGAGCTGGACAGCGGGGAGAACG C 8703089
chr5 172076137 rs536748936 CTGTCTGGAGCTGGACAGCGGGGAGAACG C 8703090

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr5 172089225 172089245 + hsa-miR-5003-3p MIMAT0021026 172068273 0.916667 0.0 7863 1343