Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 178679885 178708730 enh22871

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 178693772 rs143028808 CCCCAGCCCCCACCTGGGCCA C 8742443

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results