Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 16276398 16291075 enh7026

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 16279950 rs545227741 CAATATTAACAACATTAATATT C 6580020

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results