Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 25580985 25601915 enh5365

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 25585653 rs13031634 T C 5593451
chr2 25585664 rs534167165 T TGCCACGGCCCCGAAGAAGAAGTGGA 5593452

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results