Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 26827705 26844535 enh18366

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 26836894 rs574099380 CAGCAGCAGGCCCAGGGCCTGCAGAGGGT C 5599665

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results