Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 28554445 28573255 enh18384
chr2 28567642 28567818 vista30821

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 28567793 rs533549506 T TGCGCAGGCACGCACATCCGTGTGC 5607852

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results