EnhancerDB
  1. Home
  2. TFBS
  3. TP53[chr2:28567788-28567806]
Chromosome characteristics of TP53[chr2:28567788-28567806]
Back to top
Enhancers possibly regulated by TP53[chr2:28567788-28567806]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 28554445 28573255 enh18384
Prostate (PC-3) Brain (SK-N-SH) Ovary Astrocyte Bone (Osteoblast) Stomach Muscle (A673) Placenta Muscle (Myoblast) Pancreas Muscle (Myotube) Uterus Blood (T-cell) Heart
chr2 28567642 28567818 vista30821
VISTA
SNP sites on TP53[chr2:28567788-28567806]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 28567793 rs533549506 T TGCGCAGGCACGCACATCCGTGTGC 5607852
Genes possibly regulated by TP53[chr2:28567788-28567806]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TP53[chr2:28567788-28567806]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results