Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 30890050 rs538601741 T A 5622753
chr2 30890063 rs139494331 T TATATCTGTCAAGGATTATTAA 5622754

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results