Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 33181985 33193025 enh60796

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 33189807 rs535741102 TATGTCAAAAATATTTTTTA T 5632155

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results