EnhancerDB
  1. Home
  2. TFBS
  3. IRF1[chr2:37601707-37601728]
Chromosome characteristics of IRF1[chr2:37601707-37601728]
Back to top
Enhancers possibly regulated by IRF1[chr2:37601707-37601728]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 37600087 37609591 enh5415
Skin (Keratinocyte) Prostate (PC-3) Prostate (RWPE1) Astrocyte Blood (OCI-LY7) Colon (HCT116) Blood (Karpas-422) Muscle (Myoblast) Muscle (Myotube) Uterus
SNP sites on IRF1[chr2:37601707-37601728]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 37601726 rs200890277 A AATGTCCTTCCAAAGTCATGC 5650858
chr2 37601726 rs377273301 A AATGTCCTTCCAAAGTCATGC 5650859
Genes possibly regulated by IRF1[chr2:37601707-37601728]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by IRF1[chr2:37601707-37601728]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results