EnhancerDB
  1. Home
  2. TFBS
  3. NFIA[chr2:68431291-68431301]
Chromosome characteristics of NFIA[chr2:68431291-68431301]
Back to top
Enhancers possibly regulated by NFIA[chr2:68431291-68431301]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 68415625 68439475 enh5621
Prostate (PC-3) Cervix (HeLa-S3) Prostate (RWPE1) Esophagus Astrocyte Blood (OCI-LY7) Blood (GM12878) Muscle (A673) Adrenal Blood (Karpas-422) Lung (PC-9) Muscle (Myoblast) Pancreas (Panc1) Uterus Blood (T-cell) Stomach
SNP sites on NFIA[chr2:68431291-68431301]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 68431296 rs7577500 C T 5820352
chr2 68431300 rs541930509 GTTAGAACTAAGGCTTCCACTTTGAGCAAA G 5820353
Genes possibly regulated by NFIA[chr2:68431291-68431301]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by NFIA[chr2:68431291-68431301]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results