Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 68652913 rs141733663 T TTGGGATACCCTCCAGGGAGTG 5822094
chr2 68652913 rs6146801 T TTGGGATACCCTCCAGGGAGTG 5822095

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results