Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 69318185 69329695 enh18633

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 69326113 rs187021108 G A 5826539
chr2 69326115 rs140464556 C CTAAATAAATAAA,CTAAATAAATAAATAAATAAA 5826540
chr2 69326115 rs56154212 C CTAAATAAATAAA 5826541
chr2 69326115 rs767176486 C CTAAATAAATAAA 5826542

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results