| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr2 | 69318185 | 69329695 | enh18633 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr2 | 69326113 | rs187021108 | G | A | 5826539 | |
| chr2 | 69326115 | rs140464556 | C | CTAAATAAATAAA,CTAAATAAATAAATAAATAAA | 5826540 | |
| chr2 | 69326115 | rs56154212 | C | CTAAATAAATAAA | 5826541 | |
| chr2 | 69326115 | rs767176486 | C | CTAAATAAATAAA | 5826542 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|