Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 98640085 98648455 enh5719

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 98641964 rs561568968 ACCTTCTTCTTGCCTTTTATACTATTG A 5904425

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results