Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 100625715 100637559 enh5735

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 100636632 rs571943370 TCCGTGGATGCTTTTCACTCC T 5911167

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results