EnhancerDB
  1. Home
  2. TFBS
  3. STAT1[chr2:102081296-102081311]
Chromosome characteristics of STAT1[chr2:102081296-102081311]
Back to top
Enhancers possibly regulated by STAT1[chr2:102081296-102081311]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 102077865 102083150 enh33524
Astrocyte Bone (Osteoblast) Pancreas Spleen Muscle (Myotube) Uterus Stomach
SNP sites on STAT1[chr2:102081296-102081311]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 102081307 rs569738385 A AAAGAACTTTTTGCTATGTTTG 5920044
chr2 102081310 rs568025293 A G 5920045
chr2 102081311 rs527576808 G A 5920046
Genes possibly regulated by STAT1[chr2:102081296-102081311]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by STAT1[chr2:102081296-102081311]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results