Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 102077865 102083150 enh33524

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 102081307 rs569738385 A AAAGAACTTTTTGCTATGTTTG 5920044
chr2 102081310 rs568025293 A G 5920045

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results