Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 188437865 188448395 enh34038

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 188438876 rs148394422 GGATAAAATACAGTAATACAGTATTTA G 6245400
chr2 188438876 rs375635308 GGATAAAATACAGTAATACAGTATTTA G 6245401

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results