EnhancerDB
  1. Home
  2. TFBS
  3. NR3C1[chr2:201629269-201629287]
Chromosome characteristics of NR3C1[chr2:201629269-201629287]
Back to top
Enhancers possibly regulated by NR3C1[chr2:201629269-201629287]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 201603725 201634495 enh19115
Skin (Keratinocyte) Prostate (PC-3) Liver (HepG2) Epithelial (MCF-7) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Esophagus Astrocyte Lung (PC-9) Bone (Osteoblast) Stomach Placenta Colon (HCT116) Breast Peripheral Blood (MM.1S) Muscle (Myoblast) Pancreas Thymus Heart
SNP sites on NR3C1[chr2:201629269-201629287]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 201629285 rs367959087 A AAAACATATCTACAGATATGTAGAT,AT 6292282
Genes possibly regulated by NR3C1[chr2:201629269-201629287]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by NR3C1[chr2:201629269-201629287]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results