Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 203291734 203296195 enh34158

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 203293257 rs556204261 GACCACAGGTGCATGCCACCAC G 6298554

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results