EnhancerDB
  1. Home
  2. TFBS
  3. NR3C1[chr2:216577503-216577521]
Chromosome characteristics of NR3C1[chr2:216577503-216577521]
Back to top
Enhancers possibly regulated by NR3C1[chr2:216577503-216577521]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 216574205 216597199 enh19202
Prostate (PC-3) Liver (HepG2) Brain (SK-N-MC) Large Intestine Esophagus Astrocyte Lung Muscle (A673) Placenta Lung (PC-9) Muscle (Myoblast) Uterus Stomach
SNP sites on NR3C1[chr2:216577503-216577521]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 216577509 rs140513881 A AAGAAAGTACTAGAAGTAATTTTTCACTC 6347983
chr2 216577509 rs71047921 A AAGAAAGTACTAGAAGTAATTTTTCACTC 6347984
chr2 216577509 rs762384660 A AAGAAAGTACTAGAAGTAATTTTTCACTC 6347985
Genes possibly regulated by NR3C1[chr2:216577503-216577521]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by NR3C1[chr2:216577503-216577521]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results