Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 218292825 218309095 enh19228

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 218305760 rs576605489 TCGCCCAGGCTGGAGTGCAGTGGCGCTG T 6361714

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results