Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 223699958 rs112226340 TCTTTTCAAAGTGAAACCAGAGG T 6388312
chr2 223699958 rs375481673 TCTTTTCAAAGTGAAACCAGAGG T 6388313

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results