Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 182333485 182365038 enh54520

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 182360888 rs551537352 ACTCGCTAATGATATGGGCT A 7240007

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results