Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 230032545 230046595 enh82121

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 230042443 rs771328826 T TTCA 6423217
chr2 230042447 rs561770819 T TCATCATCATCATCATCATCAC 6423218

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results