Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 232239665 232246775 enh53612

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 232246208 rs533746158 CTGCTGCACTCCCTCCTCCA C 6434719
chr2 232246210 rs111064842 G C 6434720

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results