Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 235918466 235923100 enh70206

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 235918718 rs138695016 CCCCCAAACTACTGAGGGTGTATCAT C 6458863

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results