Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 240070165 240075775 enh99822

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 240073184 rs367615366 T TGAGTGACTGGTTTCAGAAGGCCCCA 6492137
chr2 240073184 rs535830779 T TGAGTGACTGGTTTCAGAAGGCCCCA 6492138

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results