EnhancerDB
  1. Home
  2. TFBS
  3. TLX1[chr3:184353219-184353233]
Chromosome characteristics of TLX1[chr3:184353219-184353233]
Back to top
Enhancers possibly regulated by TLX1[chr3:184353219-184353233]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 184350905 184365355 enh21163
Bone Marrow (K562) Prostate (PC-3) Brain (SK-N-MC) Large Intestine Prostate (RWPE1) Stomach Placenta Breast Thyroid Lung (PC-9) Pancreas Uterus Thymus Epithelial (MCF-7)
SNP sites on TLX1[chr3:184353219-184353233]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 184353224 rs543886327 G A 7250196
chr3 184353228 rs544639627 GGCCAGGATCTGACTCTGACACTGGCCT G 7250197
Genes possibly regulated by TLX1[chr3:184353219-184353233]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TLX1[chr3:184353219-184353233]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results