EnhancerDB
  1. Home
  2. TFBS
  3. NFE[chr2:241949208-241949212]
Chromosome characteristics of NFE[chr2:241949208-241949212]
Back to top
Enhancers possibly regulated by NFE[chr2:241949208-241949212]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 241945802 241953855 enh6227
Prostate (PC-3) Brain (SK-N-MC) Ovary Blood (T-cell) Astrocyte Bone (Osteoblast) Muscle (A673) Blood (Karpas-422) Pancreas Uterus Thymus Stomach
SNP sites on NFE[chr2:241949208-241949212]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 241949210 rs143842304 TGTCCCATGTGTGTTTCCCCGGAGGC T 6503137
chr2 241949210 rs796206438 TGTCCCATGTGTGTTTCCCCGGAGGC T 6503138
Genes possibly regulated by NFE[chr2:241949208-241949212]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by NFE[chr2:241949208-241949212]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results