Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 241945802 241953855 enh6227

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 241949210 rs143842304 TGTCCCATGTGTGTTTCCCCGGAGGC T 6503137
chr2 241949210 rs796206438 TGTCCCATGTGTGTTTCCCCGGAGGC T 6503138

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results