| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr9 | 33372851 | 33382935 | enh25536 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr9 | 33381646 | rs371813192 | GTCAGATACAGTCATCCTCCCTGGATTCCCTGTGATC | G | 10996031 | |
| chr9 | 33381646 | rs571837952 | GTCAGATACAGTCATCCTCCCTGGATTCCCTGTGATC | G | 10996032 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|