Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 34435450 34457161 enh41871

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 34451532 rs545715963 CCCTTTCCAGACACGAGGCTCCACCTG C 11000613

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results