EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr9:34451521-34451537]
Chromosome characteristics of ZNF143[chr9:34451521-34451537]
Back to top
Enhancers possibly regulated by ZNF143[chr9:34451521-34451537]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 34435450 34457161 enh41871
Bone Marrow (K562) Brain (SK-N-MC) Esophagus Astrocyte Bone (Osteoblast) Stomach Muscle (A673) Neural Stem Cells (H9) Heart
SNP sites on ZNF143[chr9:34451521-34451537]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 34451532 rs545715963 CCCTTTCCAGACACGAGGCTCCACCTG C 11000613
Genes possibly regulated by ZNF143[chr9:34451521-34451537]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr9:34451521-34451537]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results