Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 36621385 36627637 enh41882

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 36626356 rs540870505 ACAAGATAAGGGTAATCACCCTAGCACCTAGACCC A 11009686

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results