Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 37468670 37480255 enh10756

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 37472100 rs150735089 G T 11014973
chr9 37472102 rs562347827 TGCAGTGAGCCATGATCATGCCACTGCACTC T 11014974

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results