EnhancerDB
  1. Home
  2. TFBS
  3. RARA[chr3:187722533-187722551]
Chromosome characteristics of RARA[chr3:187722533-187722551]
Back to top
Enhancers possibly regulated by RARA[chr3:187722533-187722551]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 187690405 187726875 enh7765
Skin (Keratinocyte) Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Brain (SK-N-MC) Large Intestine Prostate (RWPE1) Blood (T-cell) Astrocyte Lung (PC-9) Blood (OCI-LY7) Stomach Thyroid Blood (Karpas-422) Muscle (Myoblast) Pancreas Muscle (Myotube) Thymus Heart
SNP sites on RARA[chr3:187722533-187722551]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 187722533 rs373101080 AAGGGACAAAAGTTCCAGGAATGTCCCC A 7271051
chr3 187722533 rs547537330 AAGGGACAAAAGTTCCAGGAATGTCCCC A 7271052
Genes possibly regulated by RARA[chr3:187722533-187722551]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by RARA[chr3:187722533-187722551]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results