Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 188032205 188051230 enh36236

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 188047336 rs375561728 C T 7274483
chr3 188047341 rs541959404 G GGATTTTGGAGCATTTTGAATTTCA 7274484

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results