Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 113512725 113519869 enh42190

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 113514035 rs573037993 AAGGCAGCATAAGGAGAGGGTTAACCTATAACTGGG A 11229102

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results