Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 114954332 114959454 enh66721

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 114954348 rs547996528 C CAAATACTGCATCAGATATACTTAA 11237317

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results