Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 115466145 115476215 enh10903

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 115469764 rs566143318 GTTTCTTTTTTTTCCTCCCGCACA G 11240340

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results