Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 190070645 190086175 enh21221

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 190079790 rs531168419 G GGTCTAACCAGTCTAACCTGGTCTAACCA 7290690

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results