EnhancerDB
  1. Home
  2. TFBS
  3. NFE[chr3:190097761-190097765]
Chromosome characteristics of NFE[chr3:190097761-190097765]
Back to top
Enhancers possibly regulated by NFE[chr3:190097761-190097765]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 190087065 190104935 enh21222
Prostate (PC-3) Cervix (HeLa-S3) Brain (SK-N-MC) Prostate (RWPE1) Astrocyte Lung (A549) Muscle (A673) Placenta Uterus Lung (PC-9) Neural Stem Cells (H9)
SNP sites on NFE[chr3:190097761-190097765]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 190097764 rs144203820 G GTCTA,GTCTATCTATTTATCTA,GTCTATCTATTTATCTATCTA 7290926
chr3 190097764 rs34203533 G GTCTA 7290927
Genes possibly regulated by NFE[chr3:190097761-190097765]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by NFE[chr3:190097761-190097765]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results